Query (optional)   in Class  

GrainGenes Marker Report: KV1/KV9

[ Printable Version ]  [ Submit comment/correction ]

Probe
KV1/KV9
Locus
Hor2
kv1.9A
kv1.9B
kv1.9C
Reference
ReferencePortyanko VA et al. (2001) A linkage map of hexaploid oat based on grass anchor DNA clones and its relationship to other oat maps Genome 44:249-265.
Type
PCR
STS
PCR primers
KV1 : 5' CCACCATGAAGACCTTCCTC
KV9 : 5' TCGCAGGATCCTGTACAACG
Sequence
X03103
Source Gene Class
B-Hordein
Source Gene
Hor2 (Hordeum)
Source Species
Hordeum vulgare



Locus for Probe
Hor2
Type
CAPS
Gene
RFLP
STS
Synonym
SynonymSex76 (Hordeum)
Chromosome
1H
Chromosome Arm
1HS
Map
Barley-Consensus-1H-34.2
[ Show all 23 ]
[ Show Nearby Loci ]
In QTL
QAa.HaTR-1H.1
[ Show all 13 ]
Map Data
Barley consensus
[ Show all 23 ]
2 Point Data
Hor2/Xris14
Species
Hordeum vulgare
Probe
Hor2
KV1/KV9
pB11
Associated Gene
Hor2 (Hordeum)
Sex76 (Hordeum)
Candidate Gene
Hor2 (Hordeum)
Gene Class
B-Hordein
beta-Hordein
Hordeins
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceNetsvetaev VP (1997) High lysine mutant of winter barley - L76 Barley Genetics Newsletter 27:51.
ReferenceKleinhofs A et al. (1993) A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome Theoretical and Applied Genetics 86:705-712.
Data Source
Blake, Tom05.04.19
Remark
The Hor2 RFLP/STS is a gene marker for the Sex76 gene.
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex,Igri x Franka,Nure x Tremois
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Steptoe x Morex; Igri x Franka
Possible Orthologs
HOR-2



Locus for Probe
kv1.9A
Type
STS
Map
Oat-OxT-1675.3
[ Show Nearby Loci ]
Map Data
Oat, OxT  Mapped_with_probe  KV1/KV9
Probe
KV1/KV9



Locus for Probe
kv1.9B
Type
STS
Map
Oat-OxT-459.4
[ Show Nearby Loci ]
Map Data
Oat, OxT  Mapped_with_probe  KV1/KV9
Probe
KV1/KV9



Locus for Probe
kv1.9C
Type
STS
Map
Oat-OxT-910
[ Show Nearby Loci ]
Map Data
Oat, OxT  Mapped_with_probe  KV1/KV9
Probe
KV1/KV9