Query (optional)   in Class  

GrainGenes Marker Report: k00019

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00019
Type
Indel
Chromosome
4H
Map
Hv-HNxH602-4H27.6
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12k14
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Codominant size polymorphism



Probe for Locus
baak12k14
Locus
k00019
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Type
PCR
PCR primers
Left 5' - AAATTATTCCCAACCCAGCC
Right 5' - TAATGCTTCAGAGGGTGCCT
Sequence
AV911280
PCR size
389