Query (optional)   in Class  

GrainGenes Marker Report: k00022

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00022
Type
SNP
Chromosome
3H
Map
Hv-HNxH602-3H54.1
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13h18
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/A
SNP structure (UNICODE) = TGGTGCTAGGRTGCTTGCAGA
Parent 1 SNP sequence = TGGTGCTAGGGTGCTTGCAGA
Parent 2 SNP sequence = TGGTGCTAGGATGCTTGCAGA



Probe for Locus
baak13h18
Locus
k00022
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = cupin family protein [Arabidopsis thaliana] sp Q9FLT3 GL34_ARATH Putative germin-like protein subfamily 3 member 4 precursor
Type
PCR
PCR primers
Left 5' - TACATGAATGAAGGGAGGGG
Right 5' - TATCGGTTATGGAGGGATGC
Sequence
AV911534
PCR size
452