Query (optional)   in Class  

GrainGenes Marker Report: k00033

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00033
Type
SNP
Chromosome
1H
Map
Hv-HNxH602-1H219.2
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13e03
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = C/G
SNP structure (UNICODE) = CATAGGGCTCSTCGTTATCAA
Parent 1 SNP sequence = CATAGGGCTCCTCGTTATCAA
Parent 2 SNP sequence = CATAGGGCTCGTCGTTATCAA



Probe for Locus
baak13e03
Locus
k00033
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = hexokinase I [Oryza sativa]
Type
PCR
PCR primers
Left 5' - TCCAGCAAGGGCTATTCTGT
Right 5' - GAGGATGCTGTCAAGGGTG
Sequence
AV911458
PCR size
361