Query (optional)   in Class  

GrainGenes Marker Report: k00046

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00046
Type
SNP
Chromosome
5H
Map
Hv-HNxH602-5H171.7
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13j10
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/A
SNP structure (UNICODE) = TGTTATACACRCGACAAAGAA
Parent 1 SNP sequence = TGTTATACACGCGACAAAGAA
Parent 2 SNP sequence = TGTTATACACACGACAAAGAA



Probe for Locus
baak13j10
Locus
k00046
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = SNF8 like protein [Arabidopsis thaliana] pir T04827 SNF8 protein homolog F10M23.380 - Arabidopsis thaliana
Type
PCR
PCR primers
Left 5' - TTGCATTGAAGCTCGACAAC
Right 5' - ACCAGTTCTGGATTATGCGG
Sequence
AV911568
PCR size
403