Query (optional)   in Class  

GrainGenes Marker Report: k00054

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00054
Type
CAPS
Chromosome
5H
Map
Hv-HNxH602-5H288.2
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12i02
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = HapII
[ Show all 6 ]



Probe for Locus
baak12i02
Locus
k00054
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = RabGAP/TBC domain-containing protein [Arabidopsis thaliana] dbj BAB08757.1 unnamed protein product [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - AGCCTGGATTGCAATGTTTT
Right 5' - GGGGCGAATGGAAACTTATT
Sequence
AV911237
PCR size
396