Query (optional)   in Class  

GrainGenes Marker Report: k00059

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00059
Type
CAPS
Chromosome
3H
Map
Hv-HNxH602-3H111.1
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13p20
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = HaeIII
[ Show all 6 ]



Probe for Locus
baak13p20
Locus
k00059
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = P0007F06.23 [Oryza sativa (japonica cultivar-group)] dbj BAB84384.1 P0007F06.23 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - GGGTCGCAGTTTTTCATCTT
Right 5' - GCTGTACCATGAACCCACCT
Sequence
AV911687
PCR size
397