Query (optional)   in Class  

GrainGenes Marker Report: k00066

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00066
Type
CAPS
Chromosome
6H
Map
Hv-HNxH602-6H93.6
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12i20
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = BstUI
[ Show all 6 ]



Probe for Locus
baak12i20
Locus
k00066
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Type
PCR
PCR primers
Left 5' - CAATTGCTACCACAAAAGGGA
Right 5' - TCCAAAGAAGGGAGAAAGGG
Sequence
AV911251
PCR size
438