Query (optional)   in Class  

GrainGenes Marker Report: k00069

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00069
Type
SNP
Chromosome
3H
Map
Hv-HNxH602-3H42.6
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13g18
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/A
[ Show all 8 ]



Probe for Locus
baak13g18
Locus
k00069
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = probable phospholipid transfer protein precursor - barley gb AAA86694.1 phospholipid transfer protein precursor
Type
PCR
PCR primers
Left 5' - GCTATCACAACCCAACCCAA
Right 5' - ACCGAACTAAACATGGCTGC
Sequence
BF627942
PCR size
373