Query (optional)   in Class  

GrainGenes Marker Report: k00074

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00074
Type
SNP
Chromosome
2H
Map
Hv-HNxH602-2H39.2
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak11h14
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = C/T
[ Show all 8 ]



Probe for Locus
baak11h14
Locus
k00074
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = OSJNBb0085F13.6 [Oryza sativa (japonica cultivar-group)] emb CAE04613.2 OSJNBb0004G23.11 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - ACCTTTCTGCCAACCTAGCA
Right 5' - AACCTCAAGGCAAAAAGGGT
Sequence
AV910952
PCR size
366