Query (optional)   in Class  

GrainGenes Marker Report: k00082

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00082
Type
SNP
Chromosome
5H
Map
Hv-HNxH602-5H58.9
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13n10
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/A
SNP structure (UNICODE) = AGAAAGGTGCRTACATAATTG
Parent 1 SNP sequence = AGAAAGGTGCGTACATAATTG
Parent 2 SNP sequence = AGAAAGGTGCATACATAATTG



Probe for Locus
baak13n10
Locus
k00082
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = short-chain dehydrogenase/reductase (SDR) family protein [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - GTGTACCAGACCCGCTCAAT
Right 5' - GACGACGATGACGAAGATGA
Sequence
AV911646
PCR size
441