Query (optional)   in Class  

GrainGenes Marker Report: k00084

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00084
Type
CAPS
Chromosome
3H
Map
Hv-HNxH602-3H243.8
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak14e02
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = AluI
[ Show all 6 ]



Probe for Locus
baak14e02
Locus
k00084
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = SET-domain transcriptional regulator family [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - CCTTGTTCTAGCCGCTTTTG
Right 5' - ATACACCCTGTGATCGCTCC
Sequence
BJ454652
PCR size
407