Query (optional)   in Class  

GrainGenes Marker Report: k00088

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00088
Type
Indel
Chromosome
3H
Map
Hv-HNxH602-3H219.8
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12c12
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Codominant size polymorphism



Probe for Locus
baak12c12
Locus
k00088
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = P0408G07.9 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - ACACTCTTTTGCAGCTCGGT
Right 5' - TCAATTGCAAGCTCACTTGG
Sequence
BJ484834
PCR size
403