Query (optional)   in Class  

GrainGenes Marker Report: k00092

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00092
Type
SNP
Chromosome
2H
Map
Hv-HNxH602-2H258.8
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13d11
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = C/G
[ Show all 8 ]



Probe for Locus
baak13d11
Locus
k00092
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Type
PCR
PCR primers
Left 5' - GGATCTTCATTTGCTCGACG
Right 5' - ACAGCCGTCACCTCCTCTT
PCR size
370