Query (optional)   in Class  

GrainGenes Marker Report: k00095

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00095
Type
SNP
Chromosome
6H
Map
Hv-HNxH602-6H201.4
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak14b08
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = T/G
[ Show all 15 ]



Probe for Locus
baak14b08
Locus
k00095
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = ABC1 family protein [Arabidopsis thaliana] dbj BAB01360.1 unnamed protein product [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - TCTTGCGTCTGATCTCGATG
Right 5' - ACACAACCTATGCCGCCTAC
Sequence
BJ454607
PCR size
426