Query (optional)   in Class  

GrainGenes Marker Report: k00097

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00097
Type
CAPS
Chromosome
1H
Map
Hv-HNxH602-1H288.1
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak14e23
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = HapII
[ Show all 6 ]



Probe for Locus
baak14e23
Locus
k00097
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = expressed protein [Arabidopsis thaliana] gb AAF02142.1 unknown protein [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - TGCGGGTTGTTCTTTCTACC
Right 5' - CGACGTGCATAGAGGAGACA
Sequence
BJ454664
PCR size
374