Query (optional)   in Class  

GrainGenes Marker Report: k00101

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00101
Type
CAPS
Chromosome
5H
Map
Hv-HNxH602-5H131.6
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak15n22
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = HhaI
[ Show all 6 ]



Probe for Locus
baak15n22
Locus
k00101
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = unknown protein F1M20.32 [imported] - Arabidopsis thaliana gb AAG52367.1 unknown protein; 89701-90979 [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - GCGTCGAGCACATGAAAGTA
Right 5' - GAGGTGGTGTATTGCTCGGT
Sequence
BJ452032
PCR size
352