Query (optional)   in Class  

GrainGenes Marker Report: k00108

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00108
Type
SNP
Chromosome
5H
Map
Hv-HNxH602-5H276.1
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak18g16
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/A
[ Show all 16 ]



Probe for Locus
baak18g16
Locus
k00108
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = OSJNBa0009K15.15 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - AATGACTGGAGCTGGAGGTG
Right 5' - TCCTGGCACTCTCACAAAGA
Sequence
BJ455816
PCR size
386