Query (optional)   in Class  

GrainGenes Marker Report: k00111

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00111
Type
SNP
Chromosome
7H
Map
Hv-HNxH602-7H61.7
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak14o13
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/T
[ Show all 11 ]



Probe for Locus
baak14o13
Locus
k00111
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = Similar to 1-aminocyclopropane-1-carboxylate synthase (U35779) [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - CATGCGAGATTAACCGGAAG
Right 5' - GATGAAAGGTGAGCTCCTCG
Sequence
BJ454815
PCR size
383