Query (optional)   in Class  

GrainGenes Marker Report: k00117

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00117
Type
Indel
Chromosome
4H
Map
Hv-HNxH602-4H48
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak17g07
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Codominant size polymorphism



Probe for Locus
baak17g07
Locus
k00117
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = OJ9990_A01.15 [Oryza sativa (japonica cultivar-group)] dbj BAC99815.1 hypothetical protein [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - CGTCTGGAAATGACAGCAGA
Right 5' - CGGTCCAGCAGGTATCCTTA
Sequence
BJ455560
PCR size
400