Query (optional)   in Class  

GrainGenes Marker Report: k00122

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00122
Type
CAPS
Chromosome
6H
Map
Hv-HNxH602-6H204.7
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak14k12
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = AvaII
[ Show all 10 ]



Probe for Locus
baak14k12
Locus
k00122
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = thylakoid-bound ascorbate peroxidase [Triticum aestivum]
Type
PCR
PCR primers
Left 5' - CAGAGCATTTTCATGGAGCA
Right 5' - CTATCCGAAGTTGGAGGACG
Sequence
BJ454752
PCR size
406