Query (optional)   in Class  

GrainGenes Marker Report: k00125

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00125
Type
CAPS
Chromosome
7H
Map
Hv-HNxH602-7H101.7
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak15p03
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = XbaI
[ Show all 10 ]



Probe for Locus
baak15p03
Locus
k00125
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = hypothetical protein [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - ACGAATGTCGATTAGCAGGC
Right 5' - GAAGAGGCTGCAGACAAACC
Sequence
BJ447620
PCR size
406