Query (optional)   in Class  

GrainGenes Marker Report: ksuF15

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuF15
Type
RFLP
Chromosome
2H
Chromosome Arm
2HL
Map
Barley-consensus-2003-2H98.2
[ Show all 14 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QHd.StMo-2H.2
QYld.StMo-2H.2
Map Data
Barley consensus
[ Show all 14 ]
Probe
pTtksuF14
pTtksuF15
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Langridge, Peter J.
Remark
Number of populations contributing to the placement of ksuF15 in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
F015
[ Show all 6 ]



Probe for Locus
pTtksuF14
Locus
ksuF15
Clone Location
GrainGenes Probe Repository



Probe for Locus
pTtksuF15
Locus
ksuF15A
[ Show all 8 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:AAGGTGGAAGTATGGTGCTA
L:AAGAAGAGGAGAAAACAGAC
Polymorphism
KSUF15 EcoRI
Linkage Group
2D
2
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.8
Clone Vector
pUC18
pUC
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Clone Authority
Gill, Bikram S.
Image
KSUF15 BROWS autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Kleinhofs, Andris96.05.08
Gill, Bikram S.92.09