Query (optional)   in Class  

GrainGenes Marker Report: ksuF15A

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuF15A
Type
RFLP
Map
Hordeum-KxM-2H156.6
[ Show Nearby Loci ]
Map Data
Barley, KxM
Probe
pTtksuF15



Probe for Locus
pTtksuF15
Locus
ksuF15A
[ Show all 8 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:AAGGTGGAAGTATGGTGCTA
L:AAGAAGAGGAGAAAACAGAC
Polymorphism
KSUF15 EcoRI
Linkage Group
2D
2
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.8
Clone Vector
pUC18
pUC
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Clone Authority
Gill, Bikram S.
Image
KSUF15 BROWS autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Kleinhofs, Andris96.05.08
Gill, Bikram S.92.09