Query (optional)   in Class  

GrainGenes Marker Report: ksuF2

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuF2
Type
RFLP
Chromosome
2H
Map
Hordeum-Bins-6H88
Hordeum-Consensus2006-DArT-2H98.2
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Barley, Consensus 2006, DArT
Probe
pTtksuF2
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source
Kleinhofs, Andris
Remark
Number of populations contributing to the placement of ksuF2 in the Barley, Consensus 2006 DArT maps = 1
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
F002a
[ Show all 16 ]



Probe for Locus
pTtksuF2
Locus
ksuF2A
[ Show all 22 ]
Type
Genomic
STS
PCR primers
R:TTCGCCATTAGAGCAACCTG
L:GGAGATGGATTCCCTTGTCC
Polymorphism
KSUF2 DraI
Linkage Group
2D / 7D (5)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUF2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09