Query (optional)   in Class  

GrainGenes Marker Report: ksuF2A

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuF2A
Type
RFLP
Synonym
SynonympTtksuF2
Chromosome
1H
Map
Barley-Consensus2-1H73.6
[ Show all 11 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 11 ]
Probe
pTtksuF2
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
F002a
[ Show all 16 ]



Probe for Locus
pTtksuF2
Locus
ksuF2A
[ Show all 22 ]
Type
Genomic
STS
PCR primers
R:TTCGCCATTAGAGCAACCTG
L:GGAGATGGATTCCCTTGTCC
Polymorphism
KSUF2 DraI
Linkage Group
2D / 7D (5)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUF2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09