Query (optional)   in Class  

GrainGenes Marker Report: ksuF34

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuF34
Type
RFLP
Map
Physical-3B59.47
[ Show Nearby Loci ]
Map Data
3B Physical
Probe
pTtksuF34
Possible Orthologs
F034a
F034b
XksuF34
XksuF34-3B



Probe for Locus
pTtksuF34
Locus
XksuF34-3B
[ Show all 10 ]
Type
Genomic
STS
PCR primers
R:GCAAAGTAGCAAGCAATCAG
L:AAAGCAGCGAGTCTATGTGT
Linkage Group
3D (2)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09