Query (optional)   in Class  

GrainGenes Marker Report: ksuF37

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuF37
Type
RFLP
Chromosome
6H
7H
Map
Barley-consensus-2003-7H126.5
Hordeum-Consensus2006-DArT-6H133.5
Hordeum-CxS-7H89.37
Hordeum-GxH-7H71.57
[ Show Nearby Loci ]
Map Data
Barley consensus 2003
Barley, Consensus 2006, DArT
Barley, CxS
Barley, GxH
Probe
pTtksuF37
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source
Langridge, Peter J.
Remark
Number of populations contributing to the placement of ksuF37 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs
F037
XksuF37
XksuF37-6A
XksuF37-6B
XksuF37-6R



Probe for Locus
pTtksuF37
Locus
XksuF37-6A
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:CACAAAGACAAAGAACTAAT
L:TTCAGATTTTCACAGATTTA
Linkage Group
6D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09