Query (optional)   in Class  

GrainGenes Marker Report: ksuG10

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuG10
Type
RFLP
Chromosome
4H
Chromosome Arm
4HL
Map
Barley-Consensus-4H20.8
Hordeum-Consensus2006-DArT-4H107.2
Hordeum-CxS-4H111.49
Wheat, Yr genes and QTL 4B57.6
[ Show Nearby Loci ]
QTL with Locus Marker
QBosr.ClSa-4H
Map Data
Barley consensus
Barley, Consensus 2006, DArT
Barley, CxS
Wheat, Yr genes and QTL
Probe
pTtksuF10
pTtksuG10
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark
Number of populations contributing to the placement of ksuG10 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs
G010
XksuG10
XksuG10-4B
XksuG10-4D
ksuG10-4B



Probe for Locus
pTtksuF10
Locus
ksuG10
Clone Location
GrainGenes Probe Repository



Probe for Locus
pTtksuG10
Locus
ksuG10
[ Show all 7 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TGTCCAGCTTCAGCGAGTAC
L:GTGTTGATGTCCTTGAGGCC
Specificity
Primer specificity verified, maps on chromosomes 4A,4BL, 4DL.
Polymorphism
KSUG10 EcoRI
Linkage Group
4D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG10 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09