Query (optional)   in Class  

GrainGenes Marker Report: ksuG43

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuG43
Type
RFLP
Map
Hordeum-Bins-2H162
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Probe
pTtksuG43
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
G043
Xksu.DGG43
XksuG43



Probe for Locus
pTtksuG43
Locus
DGG43
Xksu.DGG43
XksuG43
ksuG43
Type
Genomic
STS
PCR primers
R:ACCTTGTCGTGCATAGGAAC
L:GGCGCATGCACCAAAATGTT
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09