Query (optional)   in Class  

GrainGenes Marker Report: ksuG62

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuG62
Type
RFLP
Map
Hordeum-GxH-3H203.53
Physical-3B59.46
[ Show Nearby Loci ]
Map Data
3B Physical
Barley, GxH
Probe
pTtksuG62
Possible Orthologs
G062a
[ Show all 12 ]



Probe for Locus
pTtksuG62
Locus
ksuG62
[ Show all 15 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
L:TTAGAAGCAGGCTATGACCA
R:TACCATCAAGACGCCAGAAG
Linkage Group
3D (9)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.7
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09