Query (optional)   in Class  

GrainGenes Marker Report: ksuH11

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuH11
Type
RFLP
Synonym
SynonympTtksuH11
Chromosome
4H
Chromosome Arm
4HL
Map
Barley-Consensus-4H84.2
[ Show all 14 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 14 ]
Probe
pTtksuH11
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source
Blake, Tom05.04.19
Remark
AksuH11 in file - mistake
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
H011
[ Show all 6 ]



Probe for Locus
pTtksuH11
Locus
XksuH11-6A
[ Show all 8 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:GTAGCCGCTAATCTCGTCTGT
L:CGATCTCATAGCGAATATGT
Linkage Group
6D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.8
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09