Query (optional)   in Class  

GrainGenes Marker Report: ksuH16

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuH16
Type
RFLP
Map
Hordeum-Bins-2H169
Wheat, Yr genes and QTL 2D77.3
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Wheat, Yr genes and QTL
Probe
pTtksuH16
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
H016
[ Show all 7 ]



Probe for Locus
pTtksuH16
Locus
XksuH16
[ Show all 10 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:CACCTTCTTCTTCTTCTACT
L:ACACTCTTCATTGGCATCTC
Polymorphism
KSUH16 EcoRV
[ Show all 6 ]
Linkage Group
2D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUH16 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09