Query (optional)   in Class  

GrainGenes Marker Report: ksuH7

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuH7
Type
RFLP
Chromosome
5H
Map
Barley-consensus-2003-5H15.7
Hordeum-CxH-5H0
Hordeum-GxH-5H59.03
Physical-3B59.6
Wheat, Yr genes and QTL 3B39.8
[ Show Nearby Loci ]
Map Data
3B Physical
Barley consensus 2003
Barley, CxH
Barley, GxH
Wheat, Yr genes and QTL
Probe
pTtksuH7
Data Source
Langridge, Peter J.
Possible Orthologs
H007
[ Show all 6 ]



Probe for Locus
pTtksuH7
Locus
ksuH7
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:GATTTCCTCCTGCGTTTAGC
L:AAGGCGACTCGTCTGACAAG
Polymorphism
KSUH7 EcoRI
KSUH7 EcoRV
KSUH7 HindIII
KSUH7 DraI
KSUH7 XbaI
Linkage Group
3D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUH7 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09