Query (optional)   in Class  

GrainGenes Marker Report: kv1.9B

[ Printable Version ]  [ Submit comment/correction ]

Locus
kv1.9B
Type
STS
Map
Oat-OxT-459.4
[ Show Nearby Loci ]
Map Data
Oat, OxT  Mapped_with_probe  KV1/KV9
Probe
KV1/KV9



Probe for Locus
KV1/KV9
Locus
Hor2
kv1.9A
kv1.9B
kv1.9C
Reference
ReferencePortyanko VA et al. (2001) A linkage map of hexaploid oat based on grass anchor DNA clones and its relationship to other oat maps Genome 44:249-265.
Type
PCR
STS
PCR primers
KV1 : 5' CCACCATGAAGACCTTCCTC
KV9 : 5' TCGCAGGATCCTGTACAACG
Sequence
X03103
Source Gene Class
B-Hordein
Source Gene
Hor2 (Hordeum)
Source Species
Hordeum vulgare