Query (optional)   in Class  

GrainGenes Marker Report: M-HVRCABG

Locus
M-HVRCABG
Type
Microsatellite
Synonym
Correct nameHVRCABG
Chromosome
4H
Map
Hordeum-Heun-4H136.5
[ Show Nearby Loci ]
Map Data
Barley, PxN
Probe
HVRCABG
Data Source
Heun, Manfred



Probe for Locus
HVRCABG
Locus
M-HVRCABG
HVRCABG
RuAc
Reference
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (AT)29.
Type
SSR
PCR primers
5' ACACCTTCCCAGGACAATCC 3'
5' CAGAGCACCGAAAAAGTCTGTA 3'
SSR size
0.182
Sequence
M55449
Source Gene Class
Ribulose bisphosphate carboxylase activase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11