Query (optional)   in Class  

GrainGenes Marker Report: M-HVCMA

[ Printable Version ]  [ Submit comment/correction ]

Locus
M-HVCMA
Type
Microsatellite
Chromosome
7H
Map
Hordeum-Heun-7H70.7
[ Show Nearby Loci ]
Map Data
Barley, PxN
Probe
HVCMA
Data Source
Heun, Manfred



Probe for Locus
HVCMA
Locus
HVCMA
M-HVCMA
HVCMA-7H
Synonym
SynonymHAR35_14731
HAR35_14732
Reference
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (AT)9.
GTAAAGCAAATGTTGAGCAACG produced clearer bands than the alternative (overlapping) primer, GAGCAACGGGAGTCTCACATAT.
Type
PCR
SSR
PCR primers
5' GCCTCGGTTTGGACATATAAAG 3'
5' GTAAAGCAAATGTTGAGCAACG 3'
SSR size
0.141
Sequence
X59264
Source Gene Class
Inhibitor of alpha-amylase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11