Query (optional)   in Class  

GrainGenes Marker Report: M-HVLEU

[ Printable Version ]  [ Submit comment/correction ]

Locus
M-HVLEU
Type
Microsatellite
Chromosome
5H
Map
Hordeum-Heun-5H90.3
[ Show Nearby Loci ]
Map Data
Barley, PxN
Probe
HVLEU
Data Source
Heun, Manfred



Probe for Locus
HVLEU
Locus
HVLEU
M-HVLEU
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (ATTT)4.
Type
SSR
PCR primers
5' TTGGAAGTGTACAGCAATGGAG 3'
5' TGAAAGGCCCCACAAGATAG 3'
TTGGAAGTGTACAGCAATGGAG
TGAAAGGCCCCACAAGATAG
SSR size
0.166
Sequence
X05167
Source Gene Class
Aleurain
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11