Query (optional)   in Class  

GrainGenes Marker Report: M-HVWAXYG

[ Printable Version ]  [ Submit comment/correction ]

Locus
M-HVWAXYG
Type
Microsatellite
Chromosome
7H
Map
Hordeum-Heun-7H8
[ Show Nearby Loci ]
Map Data
Barley, PxN
Probe
HVWAXYG
Data Source
Heun, Manfred
Possible Orthologs
HvWaxy
[ Show all 10 ]



Probe for Locus
HVWAXYG
Locus
M-HVWAXYG
HvWaxyG
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceFu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038.
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (AT)9.
In 369 Avena sterilis accessions there were 2 alleles of size 180-182 bp, PIC = 0.95.
Type
PCR
SSR
EST
PCR primers
5' TCCAATGGCATCTACAGGACGGCCAA 3'
5' GCAGGTTGAGCTGCGCAAAGTCGTCG 3'
TCCAATGGCATCTACAGGACGGCCAA
GCAGGTTGAGCTGCGCAAAGTCGTCG
SSR size
0.205
Sequence
X07931
Source Gene Class
Starch synthase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11
Langridge, Peter J.
Fu, Yong-Bi2007.04