Query (optional)   in Class  

GrainGenes Marker Report: M148

[ Printable Version ]  [ Submit comment/correction ]

Locus
M148
Type
RFLP
Map
Tt-Gill-1D84.8
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuM148
Possible Orthologs
XksuM148



Probe for Locus
pTtksuM148
Locus
M148
XksuM148
Type
Genomic
STS
PCR primers
R:TTGCTCCCTTCATAAAACAT
L:AAGTGAGTGCCTTCTCTTCT
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09