Query (optional)   in Class  

GrainGenes Marker Report: M149

[ Printable Version ]  [ Submit comment/correction ]

Locus
M149
Probe
pTtksuM149
Possible Orthologs
DGM149
M149a
M149b
XksuM149



Probe for Locus
pTtksuM149
Locus
DGM149
M149
M149a
M149b
XksuM149
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:ACAACTCCCCTTCACTGTTC
L:GCTCATCGTTCACTTGTACC
Amplification Conditions
Anneal at 45oC
Linkage Group
2D, 4D (2)
Insert Enzyme
PstI
Source Species
Triticum tauschii
Source Tissue
leaf
Insert Size
1.8
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
Gill, Bikram S.
Data Source
Talbert, Luther E.95.07.06
ATMI92.09
Gill, Bikram S.92.09