Query (optional)   in Class  

GrainGenes Marker Report: Nar7

[ Printable Version ]  [ Submit comment/correction ]

Locus
Nar7
Type
Gene
RFLP
Synonym
SynonymNar7 (Hordeum)
Chromosome
6H
Chromosome Arm
6HL
Map
[ Hide all but 1 of 18 ]
Barley-Consensus-6H18.1
Barley-Consensus2-6H83.5
Hordeum-Bins-6H92.7
Hordeum-Consensus2005-SNP-6H94.758
Hordeum-Consensus2006-DArT-6H94.7
Hordeum-Consensus2007-SSR-6H84.66
Hordeum-NABGMP1-6H76
Hordeum-OPA-2009-6H140.62
Hordeum-PilotOPA1-6H92.8
Hordeum-QTLConsensus-Abiotic-6H94.76
Hordeum-QTLConsensus-Agronomic-6H94.76
Hordeum-StMo-SNP-6H86.03
Hordeum-SxM-base-6H93.5
Hordeum-SxM-FeedQTL-6H76
Hordeum-SxM-SSAP-6H92.1
Hordeum-SxM-SSR-6H101.1
Hv-Consensus2006-Marcel-6H84.66
Hv-Integrated2009-6H85.1
[ Show Nearby Loci ]
QTL with Locus Marker
QHt.StMo-6H
Map Data
[ Hide all but 1 of 18 ]
Barley consensus
Barley consensus 2
Barley, Abiotic QTL Consensus
Barley, Agronomic QTL Consensus
Barley, BinMap 2005
Barley, Consensus 2005, SNP
Barley, Consensus 2006, DArT
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, OPA 2009, Consensus
Barley, Pilot OPA1, Consensus
Barley, Steptoe x Morex, SNP
Barley, Steptoe x Morex, SSAP
Barley, Steptoe x Morex, SSR
Barley, SxM
Barley, SxM basemap
Barley, SxM, Feed QTLs
Species
Hordeum vulgare
Probe
NAR7
pMJ4.1
Associated Gene
Nar7 (Hordeum)
Candidate Gene
Nar7 (Hordeum)
Gene Class
NAD(P)H bispecific nitrate reductase
Reference
ReferenceClose TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582.
[ Show all 6 ]
Data Source
Blake, Tom05.04.19
Close, Timothy J.
Remark
Number of populations contributing to the placement of Nar7 in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'



Probe for Locus
pMJ4.1
Locus
Nar7
NAR7a
NAR7b
Nar7-6H
Synonym
SynonymHAR35_17981
HAR35_6525
External Databases
DDBJ
EMBL
GenBank
Reference
ReferenceMiyazaki J et al. (1991) Characterization and sequence of a novel nitrate reductase from barley. Molecular and General Genetics 228:329-334.
General Remarks
The SphI - SacII fragment is from 257 bp upstream from the ATG to 180 bp downstream from ATG
Type
Genomic
Sequence
X60173
Linkage Group
6
Source Gene Class
NAD(P)H bispecific nitrate reductase
Source Gene
Nar7 (Hordeum)
Source Species
Hordeum vulgare
Insert Size
3.538
0.44
Clone Vector
pBS
Excision Enzyme
SphI
SacII
Clone Location
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Data Source
Kleinhofs, Andris96.05.08
Information Source
Referencevon Wettstein-Knowles P (1993) Barley (Hordeum vulgare) 2N = 14. Genetic maps : locus maps of complex genomes..



Gene Associated with Locus
Nar7 (Hordeum)
Gene Class
NAD(P)H bispecific nitrate reductase
Locus
Nar7
X60173
Candidate Locus
Nar7
Reference
ReferenceKleinhofs A and Kilian A (1994) DNA based markers in plants. 1.
Chromosome
6H
Clone
pMJ4.1
Info Source
Referencevon Wettstein-Knowles P (1993) Barley (Hordeum vulgare) 2N = 14. Genetic maps : locus maps of complex genomes..



Gene Candidate for Locus
Nar7 (Hordeum)
Gene Class
NAD(P)H bispecific nitrate reductase
Locus
Nar7
X60173
Candidate Locus
Nar7
Reference
ReferenceKleinhofs A and Kilian A (1994) DNA based markers in plants. 1.
Chromosome
6H
Clone
pMJ4.1
Info Source
Referencevon Wettstein-Knowles P (1993) Barley (Hordeum vulgare) 2N = 14. Genetic maps : locus maps of complex genomes..



Probe
NAR7
Locus
Nar7
XNar7-6A
XNar7-6B
NAR7(B)
NAR7(A)
Remarks
NAD(P)H nitrate reductase
Type
Genomic
STS
PCR primers
TCACCGAGTTGATGTTGAGC
TTCGACCTCTTCTCCTCCTC
Specificity
Does not map at Steptoe x Morex locus Nar7
Linkage Group
6L
Source Species
Hordeum vulgare
Insert Size
0.9
Clone Vector
pBS
Excision Enzyme
EcoRI
NotI
Clone Location
Kleinhofs, Andris
Clone Authority
Blake, Tom
Kleinhofs, Andris
Data Source
Blake, Tom93.04.09
ATMI92.09
Karakousis, Angelo96.10



Locus for Probe
NAR7(A)
Type
RFLP
Map
Hordeum-CxH-6H100.38
Hordeum-GxH-6H122.48
[ Show Nearby Loci ]
Map Data
Barley, CxH  Mapped_with_probe  NAR7
Barley, GxH  Mapped_with_probe  NAR7
Probe
NAR7



Locus for Probe
NAR7(B)
Type
RFLP
Map
Hordeum-CxH-6H15.17
Hordeum-GxH-6H17.3
[ Show Nearby Loci ]
Map Data
Barley, CxH  Mapped_with_probe  NAR7
Barley, GxH  Mapped_with_probe  NAR7
Probe
NAR7



Locus for Probe
XNar7-6A
Type
RFLP
Map
Tm-Dubcovsky2-6A12.2
Tturgidum-Du-6A21.1
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
T. turgidum, durum x dicoccoides
Probe
NAR7



Locus for Probe
XNar7-6B
Type
RFLP
Map
Tturgidum-Du-6B12.9
[ Show Nearby Loci ]
Map Data
T. turgidum, durum x dicoccoides
Probe
NAR7