Query (optional)   in Class  

GrainGenes Marker Report: NAR1

[ Printable Version ]  [ Submit comment/correction ]

Locus
Nar1
Type
Gene
RFLP
Synonym
SynonymNar1 (Hordeum)
Chromosome
6H
Chromosome Arm
6HS
Map
Barley-Consensus-6H-52.2
[ Show all 16 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QHd.StMo-6H
QMe.StMo-6H
Map Data
Barley consensus
[ Show all 16 ]
Probe
bNRp30
NAR1
Associated Gene
Nar1 (Hordeum)
Candidate Gene
Nar1 (Hordeum)
Gene Class
NADH nitrate reductase
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of Nar1 in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex



Probe for Locus
bNRp30
Locus
Nar1
External Databases
DDBJ
EMBL
GenBank
Reference
ReferenceSchnorr KM et al. (1991) Analysis of barley nitrate reductase complementary DNA and genomic clones Molecular and General Genetics 227:411-416.
General Remarks
Very polymorphic and excellent single copy probe
EcoRI releases the insert; DraI is used to cut the vector, otherwise insert and vector about the same size. No DraI sites in the insert.
Type
cDNA
Sequence
X57845
Linkage Group
6
Source Gene Class
NADH nitrate reductase
Source Gene
Nar1 (Hordeum)
Source Species
Hordeum vulgare
Insert Size
2.924
3
Clone Vector
pBS
Excision Enzyme
EcoRI
DraI
Clone Location
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Data Source
Kleinhofs, Andris96.05.08
Information Source
Referencevon Wettstein-Knowles P (1993) Barley (Hordeum vulgare) 2N = 14. Genetic maps : locus maps of complex genomes..



Gene Associated with Locus
Nar1 (Hordeum)
Gene Class
NADH nitrate reductase
Locus
Nar1
Candidate Locus
Nar1
Reference
ReferenceKleinhofs A et al. (1988) Mapping of nitrate reductase genes in barley and wheat. Proceedings of the 7th International Wheat Genetics Symposium 541-546.
Chromosome
6H
Clone
bNRp10
bNRp30
pPMJ7-8
Info Source
Referencevon Wettstein-Knowles P (1993) Barley (Hordeum vulgare) 2N = 14. Genetic maps : locus maps of complex genomes..



Gene Candidate for Locus
Nar1 (Hordeum)
Gene Class
NADH nitrate reductase
Locus
Nar1
Candidate Locus
Nar1
Reference
ReferenceKleinhofs A et al. (1988) Mapping of nitrate reductase genes in barley and wheat. Proceedings of the 7th International Wheat Genetics Symposium 541-546.
Chromosome
6H
Clone
bNRp10
bNRp30
pPMJ7-8
Info Source
Referencevon Wettstein-Knowles P (1993) Barley (Hordeum vulgare) 2N = 14. Genetic maps : locus maps of complex genomes..



Probe
NAR1
Locus
Nar1
Remarks
NADH nitrate reductase
Type
Genomic
STS
PCR primers
ATGTCCTCCGTCACAAACCC
AGTACTTCCGTCCATGCTCG
Specificity
Does not map at Steptoe x Morex locus Nar1
Linkage Group
6S
Source Species
Hordeum vulgare
Insert Size
3
Clone Vector
pBS
Excision Enzyme
EcoRI
DraI
Clone Location
Kleinhofs, Andris
Clone Authority
Blake, Tom
Data Source
Blake, Tom93.04.09
ATMI92.09