Query (optional)   in Class  

GrainGenes Marker Report: R-A1

[ Printable Version ]  [ Submit comment/correction ]

Locus
R-A1
Type
Trait
Chromosome
3A
Chromosome Arm
3AL
Map
Wheat-Composite2004-3A118
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
WMS155
Associated Gene
R-A1 (Triticum)
Gene Class
Grain color
Reference
ReferenceSherman JD et al. (2008) Microsatellite Markers for Kernel Color Genes in Wheat Crop Science 48:1419-1424.
Remark
Trait marker Xgwm155-3A
Nearby marker on Composite map: Xgwm155
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS155
Locus
Xgwm155
[ Show all 13 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)19
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CAATCATTTCCCCCTCCC 3'
5' AATCATTGGAAATCCATATGCC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS155
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
R-A1 (Triticum)
Gene Class
Grain color
Locus
R-A1
Chromosome
3A
Chromosome Arm
3AL