Query (optional)   in Class  

GrainGenes Marker Report: R-D1

[ Printable Version ]  [ Submit comment/correction ]

Locus
R-D1
Type
Trait
Chromosome
3D
Chromosome Arm
3DL
Map
Wheat-Composite2004-3B112
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
WMS3
Associated Gene
R-D1 (Triticum)
Gene Class
Grain color
Reference
ReferenceSherman JD et al. (2008) Microsatellite Markers for Kernel Color Genes in Wheat Crop Science 48:1419-1424.
Remark
Trait marker Xgwm3-3D
Nearby marker on Composite map: Xgwm3
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS3
Locus
Xgwm3-3D
[ Show all 7 ]
Reference
ReferenceFu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
ReferenceRoeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks
Insert contains repeat (CA)18
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Repeat type (CA)x18.
Product size 84 bp in Cheyenne.
In 369 Avena sterilis accessions there were 3 alleles of size 44-50 bp, PIC = negative.
Type
Genomic
PCR
SSR
PCR primers
5' GCAGCGGCACTGGTACATTT 3'
5' AATATCGCATCACTATCCCA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS3
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Roeder, Marion S.94.10.17
Fu, Yong-Bi2007.04



Gene Associated with Locus
R-D1 (Triticum)
Gene Class
Grain color
Locus
R-D1
Chromosome
3D
Chromosome Arm
3DL