Query (optional)   in Class  

GrainGenes Marker Report: rast1_4

[ Printable Version ]  [ Submit comment/correction ]

Locus
rast1_4
Type
Microsatellite
Map
Oat-OxT-1154.3
[ Show Nearby Loci ]
Map Data
Oat, OxT  Mapped_with_probe  rast1-4
Probe
rast1-4
Associated Gene
Rast1-4 (Avena)
Gene Class
Pathogenesis-related protein



Probe for Locus
rast1-4
Locus
rast1_4
Reference
ReferencePortyanko VA et al. (2001) A linkage map of hexaploid oat based on grass anchor DNA clones and its relationship to other oat maps Genome 44:249-265.
General Remarks
Targets SSR region of a thaumatin-like pathogenesis-related protein
Type
SSR
PCR primers
5' CTTCTGCCCATGAAACCCTA
5' GAGGGTGCATGTGCTGAGT
Sequence
L39777
Source Gene Class
Pathogenesis-related protein
Source Gene
Rast1-4 (Avena)
Source Species
Avena sativa



Gene Associated with Locus
Rast1-4 (Avena)
Gene Class
Pathogenesis-related protein
Locus
rast1_4
Reference
ReferencePortyanko VA et al. (2001) A linkage map of hexaploid oat based on grass anchor DNA clones and its relationship to other oat maps Genome 44:249-265.
Clone
rast1-4
Sequence
L39777