Query (optional)   in Class  

GrainGenes Marker Report: SukEM59c

[ Printable Version ]  [ Submit comment/correction ]

Locus
SukEM59c
Type
SSAP
Chromosome
1H
Map
Hordeum-SxM-SSAP-1H135.8
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Probe for Locus
SukEM59
Locus
[ Hide all but 1 of 26 ]
SukEM49j
SukEM59m
SukEM59g
SukEM59n
SukEM49k
SukEM49h
SukEM59d
SukEM59k
SukEM59h
SukEM49i
SukEM49c
SukEM59e
SukEM49b
SukEM59a
SukEM59b
SukEM59f
SukEM49e
SukEM59o
SukEM59c
SukEM49d
SukEM59l
SukEM59j
SukEM49f
SukEM49a
SukEM49g
SukEM59i
Reference
ReferenceLeigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
General Remarks
Position of retroposon-based primer in the LTR = 5' and 6 nucleotides internal to the LTR terminus
MseI primer (KeyGene code) = CTA (M59)
Type
PCR
STS
PCR primers
Sukkula-E0228 5' GGAACGTCGGCATCGGGCTG 3'
Mse1 primer M59 5' GATGAGTCCTGAGTAACTA 3'
Amplification Conditions
amplified as Vos et al Nucl Acids Res 23: 4407-4418
Source Species
Hordeum vulgare