Query (optional)   in Class  

GrainGenes Marker Report: S-B1

[ Printable Version ]  [ Submit comment/correction ]

Locus
S-B1
Type
Trait
Chromosome
3B
Chromosome Arm
3BS
Map
Wheat-Composite2004-3B48.5
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
WMS566
Associated Gene
S-B1 (Triticum)
Gene Class
Sphaerococcum
Reference
ReferenceSalina E et al. (2000) Microsatellite mapping of the induced sphaerococcoid mutation genes in Triticum aestivum Theoretical and Applied Genetics 100:686-689.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm566-3B
Nearby marker on Composite map: Xgwm566
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS566
Locus
Xgwm566-3B
[ Show all 8 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)21(GA)2(TA)8
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TCTGTCTACCCATGGGATTTG 3'
5' CTGGCTTCGAGGTAAGCAAC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS566
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
S-B1 (Triticum)
Gene Class
Sphaerococcum
Locus
S-B1
Reference
ReferenceSalina E et al. (2000) Microsatellite mapping of the induced sphaerococcoid mutation genes in Triticum aestivum Theoretical and Applied Genetics 100:686-689.