Query (optional)   in Class  

GrainGenes Marker Report: SUN2

[ Printable Version ]  [ Submit comment/correction ]

Locus
sun2
Map
Physical-3B3.67
[ Show Nearby Loci ]
Map Data
3B Physical



Probe
SUN2
Locus
Xsun2-3B
Reference
ReferenceLiu SX and Anderson JA (2003) Marker assisted evaluation of Fusarium head blight resistant wheat germplasm Crop Science 43:760-766.
ReferenceSharp PJ et al. (2001) Validation of molecular markers for wheat breeding Australian Journal of Agricultural Research 52:1357-1366.
Remarks
Derived from RFLP marker Xglk683
Type
PCR
STS
PCR primers
Forward 5' CTAAGATACCAAGAACAGAGC
Reverse 5' GCACTCCTCAAACACTTAAGC
Source Species
Triticum aestivum



Locus for Probe
Xsun2-3B
Type
STS
Chromosome
3B
Chromosome Arm
3BS
Map
Triticum-FHB-QTL-physical-3BS-83
Triticum-SxS-FHB-QTL/2003-3BS13
[ Show Nearby Loci ]
Breakpoint Interval
3BS-8/3BS3
Map Data
Wheat, FHB QTL, Physical
Wheat, SxS, FHB QTL, 2003
Probe
SUN2
Reference
ReferenceLiu SX and Anderson JA (2003) Marker assisted evaluation of Fusarium head blight resistant wheat germplasm Crop Science 43:760-766.