Query (optional)   in Class  

GrainGenes Marker Report: Suk9M49l

[ Printable Version ]  [ Submit comment/correction ]

Locus
Suk9M49l
Type
SSAP
Chromosome
1H
Map
Hordeum-SxM-SSAP-1H69.8
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
Suk9M49
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Probe for Locus
Suk9M49
Locus
Suk9M49b
[ Show all 13 ]
Reference
ReferenceLeigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
General Remarks
Position of retroposon-based primer in the LTR = 3' and 1 nucleotide internal to the LTR terminus
MseI primer (KeyGene code) = CAG (M49)
Type
PCR
STS
PCR primers
Sukkula-9900 5' GATAGGGTCGCATCTTGGGCGTGAC 3'
Mse1 primer M49 5' GATGAGTCCTGAGTAACAG 3'
Amplification Conditions
amplified as Vos et al Nucl Acids Res 23: 4407-4417
Source Species
Hordeum vulgare